For Samtools/hts-spec developers

Perhaps someone from samtools/hts-spec may discover this page. I tried to check the license of the hts-spec, but it's not clear. I am very very eager to understand the content of the hts-spec. This page has been created for the purpose of adapting Google translation to hts-spec. The official PDFs do not provide a satisfactory machine translation. If you have any problems with redistribution, please let me know in the comments section. Best regards.

Sequence Alignment/Map Format Specification

The SAM/BAM Format Specification Working Group

19 Jul 2020

The master version of this document can be found at https://github.com/samtools/hts-specs.
This printing is version be41814 from that repository, last modified on the date shown above.

1 The SAM Format Specification

SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text format consisting of a header section, which is optional, and an alignment section. If present, the header must be prior to the alignments. Header lines start with ‘@’, while alignment lines do not. Each alignment line has 11 mandatory fields for essential alignment information such as mapping position, and variable number of optional fields for flexible or aligner specific information.

This specification is for version 1.6 of the SAM and BAM formats. Each SAM and BAM file may optionally specify the version being used via the @HD VN tag. For full version history see Appendix B.

Unless explicitly specified elsewhere, all fields are encoded using 7-bit US-ASCII ¹ in using the POSIX / C locale. Regular expressions listed use the POSIX / IEEE Std 1003.1 extended syntax.

1.1 An example

Suppose we have the following alignment with bases in lowercase clipped from the alignment. Read r001/1 and r001/2 constitute a read pair; r003 is a chimeric read; r004 represents a split alignment.

Coor 12345678901234 5678901234567890123456789012345
ref AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT
+r001/1 TTAGATAAAGGATA*CTG
+r002 aaaAGATAA*GGATA
+r003 gcctaAGCTAA
+r004 ATAGCT..............TCAGC
-r003 ttagctTAGGC
-r001/2 CAGCGGCAT

The corresponding SAM format is:²

@HD VN:1.6 SO:coordinate
@SQ SN:ref LN:45
r001 99 ref 7 30 8M2I4M1D3M = 37 39 TTAGATAAAGGATACTG *
r002 0 ref 9 30 3S6M1P1I4M * 0 0 AAAAGATAAGGATA *
r003 0 ref 9 30 5S6M * 0 0 GCCTAAGCTAA * SA:Z:ref,29,-,6H5M,17,0;
r004 0 ref 16 30 6M14N5M * 0 0 ATAGCTTCAGC *
r003 2064 ref 29 17 6H5M * 0 0 TAGGC * SA:Z:ref,9,+,5S6M,30,1;
r001 147 ref 37 30 9M = 7 -39 CAGCGGCAT * NM:i:1

1.2 Terminologies and Concepts

Template : A DNA/RNA sequence part of which is sequenced on a sequencing machine or assembled from raw sequences.

Segment : A contiguous sequence or subsequence.

Read : A raw sequence that comes off a sequencing machine. A read may consist of multiple segments. For sequencing data, reads are indexed by the order in which they are sequenced.

Linear alignment : An alignment of a read to a single reference sequence that may include insertions, deletions, skips and clipping, but may not include direction changes (i.e., one portion of the alignment on forward strand and another portion of alignment on reverse strand). A linear alignment can be represented in a single SAM record.

Chimeric alignment : An alignment of a read that cannot be represented as a linear alignment. A chimeric alignment is represented as a set of linear alignments that do not have large overlaps. Typically, one of the linear alignments in a chimeric alignment is considered the \representative" alignment, and the others are called \supplementary" and are distinguished by the supplementary alignment flag. All the SAM records in a chimeric alignment have the same QNAME and the same values for 0x40 and 0x80 flags (see Section 1.4). The decision regarding which linear alignment is representative is arbitrary.

Read alignment : A linear alignment or a chimeric alignment that is the complete representation of the alignment of the read.

Multiple mapping : The correct placement of a read may be ambiguous, e.g., due to repeats. In this case, there may be multiple read alignments for the same read. One of these alignments is considered primary. All the other alignments have the secondary alignment flag set in the SAM records that represent them. All the SAM records have the same QNAME and the same values for 0x40 and 0x80 flags. Typically the alignment designated primary is the best alignment, but the decision may be arbitrary.³

1-based coordinate system : A coordinate system where the first base of a sequence is one. In this coordinate system, a region is specified by a closed interval. For example, the region between the 3rd and the 7th bases inclusive is [3; 7]. The SAM, VCF, GFF and Wiggle formats are using the 1-based coordinate system.

0-based coordinate system : A coordinate system where the first base of a sequence is zero. In this coordinate system, a region is specified by a half-closed-half-open interval. For example, the region between the 3rd and the 7th bases inclusive is [2; 7). The BAM, BCFv2, BED, and PSL formats are using the 0-based coordinate system.

Phred scale : Given a probability 0 < p ≤ 1, the phred scale of p equals −10 log10 p, rounded to the closest integer.

1.2.1 Character set restrictions

Reference sequence names, CIGAR strings, and several other field types are used as values or parts of values of other fields in SAM and related formats such as VCF. To ensure that these other fields’ representations are unambiguous, these field types disallow particular delimiter characters.

Query or read names may contain any printable ASCII characters in the range [!-~] apart from ‘@’, so that SAM alignment lines can be easily distinguished from header lines. (They are also limited in length.)

Reference sequence names may contain any printable ASCII characters in the range [!-~] apart from backslashes, commas, quotation marks, and brackets|i.e., apart from ‘\ , "‘’ () [] {} <>’|and may not start with ‘*’ or ‘=’. ⁴
Thus they match the following regular expression:

[0-9A-Za-z!#$%&+./:;?@^_|~-][0-9A-Za-z!#$%&*+./:;=?@^_|~-]*

For clarity, elsewhere in this specification we write this set of allowed characters as a character class [:rname:] and extend the POSIX regular expression notation to use ^= to indicate the omission of ‘’ and ‘=’ from the character class. Thus this regular expression can be written more clearly as [:rname:^=][:rname:].

1.3 The header section

Each header line begins with the character ‘@’ followed by one of the two-letter header record type codes defined in this section. In the header, each line is TAB-delimited and, apart from @CO lines, each data field follows a format ‘TAG:VALUE’ where TAG is a two-character string that defines the format and content of VALUE. Thus header lines match /^@(HD|SQ|RG|PG)(\t[A-Za-z][A-Za-z0-9]:[ -~]+)+$/ or /^@CO\t.*/.

The following table describes the header record types that may be used and their predefined tags. Tags listed with ‘*’ are required; e.g., every @SQ header line must have SN and LN fields. As with alignment optional fields (see Section 1.5), you can freely add new tags for further data fields. Tags containing lowercase letters are reserved for local use and will not be formally defined in any future version of this specification.⁵

Tag	Description
@HD	File-level metadata. Optional. If present, there must be only one @HD line and it must be the first line of the file.
VN*	Format version. Accepted format: /^[0-9]+.[0-9]+$/.
SO	Sorting order of alignments. Valid values: unknown (default), unsorted, queryname and coordinate. For coordinate sort, the major sort key is the RNAME field, with order defined by the order of @SQ lines in the header. The minor sort key is the POS field. For alignments with equal RNAME and POS, order is arbitrary. All alignments with ‘*’ in RNAME field follow alignments with some other value but otherwise are in arbitrary order. For queryname sort, no explicit requirement is made regarding the ordering other than that it be applied consistently throughout the entire file.⁶
GO	Grouping of alignments, indicating that similar alignment records are grouped together but the file is not necessarily sorted overall. Valid values: none (default), query (alignments are grouped by QNAME), and reference (alignments are grouped by RNAME/POS).
SS	Sub-sorting order of alignments. Valid values are of the form sort-order:sub-sort, where sortorder is the same value stored in the SO tag and sub-sort is an implementation-dependent colon-separated string further describing the sort order, but with some predefined terms defined in Section 1.3.1. For example, if an algorithm relies on a coordinate sort that, at each coordinate, is further sorted by query name then the header could contain @HD SO:coordinate SS:coordinate:queryname.⁷ If the primary sort is not one of the predefined primary sort orders, then unsorted should be used and the subsort is effectively the major sort. For example, if sorted by an auxiliary tag MI then by coordinate then the header could contain @HD SO:unsorted SS:unsorted:MI:coordinate.Regular expression: (coordinate
@SQ	Reference sequence dictionary. The order of @SQ lines defines the alignment sorting order.
SN*	Reference sequence name. The SN tags and all individual AN names in all @SQ lines must be distinct. The value of this field is used in the alignment records in RNAME and RNEXT fields. Regular expression: [:rname:^=][:rname:]
LN*	Reference sequence length. Range: [1; 231 − 1]
AH	Indicates that this sequence is an alternate locus.⁸ The value is the locus in the primary assembly for which this sequence is an alternative, in the format ‘chr:start-end’, ‘chr’ (if known), or ‘*’ (if unknown), where ‘chr’ is a sequence in the primary assembly. Must not be present on sequences in the primary assembly.
AN	Alternative reference sequence names. A comma-separated list of alternative names that tools may use when referring to this reference sequence.⁹ These alternative names are not used elsewhere within the SAM file; in particular, they must not appear in alignment records’ RNAME or RNEXT fields. Regular expression: name(,name)* where name is [:rname:^=][:rname:]
AS	Genome assembly identifier.
DS	Description. UTF-8 encoding may be used.
M5	MD5 checksum of the sequence. See Section 1.3.2
SP	Species.
TP	Molecule topology. Valid values: linear (default) and circular.¹⁰
UR	URI of the sequence. This value may start with one of the standard protocols, e.g., ‘http:’ or ‘ftp:’. If it does not start with one of these protocols, it is assumed to be a file-system path.
@RG	Read group. Unordered multiple @RG lines are allowed.
ID*	Read group identifier. Each @RG line must have a unique ID. The value of ID is used in the RG tags of alignment records. Must be unique among all read groups in header section. Read group IDs may be modified when merging SAM files in order to handle collisions.
BC	Barcode sequence identifying the sample or library. This value is the expected barcode bases as read by the sequencing machine in the absence of errors. If there are several barcodes for the sample/library (e.g., one on each end of the template), the recommended implementation concatenates all the barcodes separating them with hyphens (‘-’).
CN	Name of sequencing center producing the read.
DS	Description. UTF-8 encoding may be used.
DT	Date the run was produced (ISO8601 date or date/time).
FO	Flow order. The array of nucleotide bases that correspond to the nucleotides used for each flow of each read. Multi-base flows are encoded in IUPAC format, and non-nucleotide flows by various other characters. Format: /*
KS	The array of nucleotide bases that correspond to the key sequence of each read.
LB	Library.
PG	Programs used for processing the read group.
PI	Predicted median insert size.
PL	Platform/technology used to produce the reads. Valid values: CAPILLARY, DNBSEQ (MGI/BGI), HELICOS, ILLUMINA, IONTORRENT, LS454, ONT (Oxford Nanopore), PACBIO (Pacific Biotechnology), and SOLID. This field should be omitted when the technology is not in this list (though the PM field may still be present in this case) or is unknown.
PM	Platform model. Free-form text providing further details of the platform/technology used.
PU	Platform unit (e.g., flowcell-barcode.lane for Illumina or slide for SOLiD). Unique identifier.
SM	Sample. Use pool name where a pool is being sequenced.
@PG	Program.
ID*	Program record identifier. Each @PG line must have a unique ID. The value of ID is used in the alignment PG tag and PP tags of other @PG lines. PG IDs may be modified when merging SAM files in order to handle collisions.
PN	Program name
CL	Command line. UTF-8 encoding may be used.
PP	Previous @PG-ID. Must match another @PG header’s ID tag. @PG records may be chained using PP tag, with the last record in the chain having no PP tag. This chain defines the order of programs that have been applied to the alignment. PP values may be modified when merging SAM files in order to handle collisions of PG IDs. The first PG record in a chain (i.e., the one referred to by the PG tag in a SAM record) describes the most recent program that operated on the SAM record. The next PG record in the chain describes the next most recent program that operated on the SAM record. The PG ID on a SAM record is not required to refer to the newest PG record in a chain. It may refer to any PG record in a chain, implying that the SAM record has been operated on by the program in that PG record, and the program(s) referred to via the PP tag.
DS	Description. UTF-8 encoding may be used.
VN	Program version
@CO	One-line text comment. Unordered multiple @CO lines are allowed. UTF-8 encoding may be used.

1.3.1 Defined sub-sort terms

While the SS sub-sort field allows implementation-defined keywords, some terms are predefined with specific meanings.

lexicographical sort order is defined as a character-based dictionary sort with the character order as defined by the POSIX C locale. For example \abc", \abc17", \abc5", \abc59" and \abcd" are in lexicographical order.

natural sort order is similar to lexicographical order except that runs of adjacent digits are considered to be numbers embedded within the text string, ordered numerically when compared to each other and ordered as single digits when compared to the surrounding non-digit characters. Runs that differ only in the number of leading zeros (thus are numerically tied) are ordered by more-zeros coming before fewer-zeros. The characters ‘-’ and ‘.’ are considered as ordinary characters, so apparently negative or fractional values are not treated as part of an embedded number. For example, \abc", \abc+5", \abc-5", \abc.d", \abc03", \abc5", \abc008", \abc08", \abc8", \abc17", \abc17.+", \abc17.2", \abc17.d", \abc59" and \abcd" are in natural order.

umi is a lexicographical sort by the UMI tag. The MI tag should be used for comparing UMIs. The RX tag may be used in its absence but is not guaranteed to be unique across multiple libraries.

1.3.2 Reference MD5 calculation

The M5 tag on @SQ lines allows reference sequences to be uniquely identified through the MD5 digest of the sequence itself. As the digest is based on the sequence and nothing else, it can help resolve ambiguities with reference naming. For example, it allows a quick way of checking that references named ‘1’, ‘Chr1’ and ‘chr1’ in different files are in fact the same.

The reference sequence must be in the 7-bit US-ASCII character set. All valid reference bases can be represented in this set, and it avoids the problem of determining exactly which 8-bit representation may have been used. Padding characters (See Section 3.2) must be represented only using the ‘*’ character.

The digest is calculated as follows:

All characters outside of the inclusive range 33 (‘!’) to 126 (‘~’) are stripped out. This removes all unprintable and whitespace characters including spaces and new lines. Everything else is retained, even if not a legal nucleotide code.
All lowercase characters are converted to uppercase. This operation is equivalent to calling toupper() on characters in the POSIX locale.
The MD5 digest is calculated as described in RFC 1321 and presented as a 32 character lowercase hexadecimal number.

As an example, if the reference contains the following characters (including spaces):

ACGT ACGT ACGT
acgt acgt acgt
... 12345 !!!

then the digest is that of the string ACGTACGTACGTACGTACGTACGT...12345!!! and the resulting tag would be M5:dfabdbb36e239a6da88957841f32b8e4.

In padded SAM files, the padding bases should be inserted into the reference as ‘*’ characters. Taking the example in Section 3.2, the padded version of the reference is

AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT

and the corresponding tag is M5:caad65b937c4bc0b33c08f62a9fb5411.

1.4 The alignment section: mandatory fields

In the SAM format, each alignment line typically represents the linear alignment of a segment. Each line　consists of 11 or more TAB-separated fields. The first eleven fields are always present and in the order shown below; if the information represented by any of these fields is unavailable, that field’s value will be a placeholder, either ‘0’ or ‘*’ as determined by the field’s type. The following table gives an overview of these mandatory fields in the SAM format:

Col	Field	Type	Regexp/Range	Brief description
1	QNAME	String	[!-?A-~]{1,254}	Query template NAME
2	FLAG	Int	[0; 216 − 1]	bitwise FLAG
3	RNAME	String	*	[:rname:^=][:rname:]
4	POS	Int	[0; 231 − 1]	1-based leftmost mapping POSition
5	MAPQ	Int	[0; 28 − 1]	MAPping Quality
6	CIGAR	String	*	([0-9]+[MIDNSHPX=])+
7	RNEXT	String	*	=
8	PNEXT	Int	[0; 231 − 1]	Position of the mate/next read
9	TLEN	Int	[−231 + 1; 231 − 1]	observed Template LENgth
10	SEQ	String	*	[A-Za-z=.]+
11	QUAL	String	[!-~]+	ASCII of Phred-scaled base QUALity+33

All mapped segments in alignment lines are represented on the forward genomic strand. For segments　that have been mapped to the reverse strand, the recorded SEQ is reverse complemented from the original unmapped sequence and CIGAR, QUAL, and strand-sensitive optional fields are reversed and thus recorded consistently with the sequence bases as represented.

QNAME: Query template NAME. Reads/segments having identical QNAME are regarded to come from the same template. A QNAME ‘*’ indicates the information is unavailable. In a SAM file, a read may occupy multiple alignment lines, when its alignment is chimeric or when multiple mappings are given.
FLAG: Combination of bitwise FLAGs.¹¹ Each bit is explained in the following table:

Bit		Description
1	0x1	template having multiple segments in sequencing
2	0x2	each segment properly aligned according to the aligner
4	0x4	segment unmapped
8	0x8	next segment in the template unmapped
16	0x10	SEQ being reverse complemented
32	0x20	SEQ of the next segment in the template being reverse complemented
64	0x40	the first segment in the template
128	0x80	the last segment in the template
256	0x100	secondary alignment
512	0x200	not passing filters, such as platform/vendor quality controls
1024	0x400	PCR or optical duplicate
2048	0x800	supplementary alignment

For each read/contig in a SAM file, it is required that one and only one line associated with the read satisfies ‘FLAG & 0x900 == 0’. This line is called the primary line of the read.
Bit 0x100 marks the alignment not to be used in certain analyses when the tools in use are aware of this bit. It is typically used to flag alternative mappings when multiple mappings are presented in a SAM.
Bit 0x800 indicates that the corresponding alignment line is part of a chimeric alignment. A line flagged with 0x800 is called as a supplementary line.
Bit 0x4 is the only reliable place to tell whether the read is unmapped. If 0x4 is set, no assumptions can be made about RNAME, POS, CIGAR, MAPQ, and bits 0x2, 0x100, and 0x800.
Bit 0x10 indicates whether SEQ has been reverse complemented and QUAL reversed. When bit 0x4 is unset, this corresponds to the strand to which the segment has been mapped: bit 0x10 unset indicates the forward strand, while set indicates the reverse strand. When 0x4 is set, this indicates whether the unmapped read is stored in its original orientation as it came off the sequencing machine.
Bits 0x40 and 0x80 reflect the read ordering within each template inherent in the sequencing technology used.13 If 0x40 and 0x80 are both set, the read is part of a linear template, but it is neither the first nor the last read. If both 0x40 and 0x80 are unset, the index of the read in the template is unknown. This may happen for a non-linear template or when this information is lost during data processing.
If 0x1 is unset, no assumptions can be made about 0x2, 0x8, 0x20, 0x40 and 0x80.
Bits that are not listed in the table are reserved for future use. They should not be set when writing and should be ignored on reading by current software.

RNAME: Reference sequence NAME of the alignment. If @SQ header lines are present, RNAME (if not ‘’) must be present in one of the SQ-SN tag. An unmapped segment without coordinate has a ‘’ at his field. However, an unmapped segment may also have an ordinary coordinate such that it can be placed at a desired position after sorting. If RNAME is ‘*’, no assumptions can be made about POS and CIGAR.
POS: 1-based leftmost mapping POSition of the first CIGAR operation that \consumes" a reference base (see table below). The first base in a reference sequence has coordinate 1. POS is set as 0 for an unmapped read without coordinate. If POS is 0, no assumptions can be made about RNAME and CIGAR.
MAPQ: MAPping Quality. It equals −10 log10 Prfmapping position is wrongg, rounded to the nearest integer. A value 255 indicates that the mapping quality is not available.
CIGAR: CIGAR string. The CIGAR operations are given in the following table (set ‘*’ if unavailable):

Op	BAM	Description	Consumes query	Consumes reference
M	0	alignment match (can be a sequence match or mismatch)	yes	yes
I	1	insertion to the reference	yes	no
D	2	deletion from the reference	no	yes
N	3	skipped region from the reference	no	yes
S	4	soft clipping (clipped sequences present in SEQ)	yes	no
H	5	hard clipping (clipped sequences NOT present in SEQ)	no	no
P	6	padding (silent deletion from padded reference)	no	no
=	7	sequence match	yes	yes
X	8	sequence mismatch	yes	yes

\Consumes query" and \consumes reference" indicate whether the CIGAR operation causes the alignment to step along the query sequence and the reference sequence respectively.
H can only be present as the first and/or last operation.
S may only have H operations between them and the ends of the CIGAR string.
For mRNA-to-genome alignment, an N operation represents an intron. For other types of alignments, the interpretation of N is not defined.
Sum of lengths of the M/I/S/=/X operations shall equal the length of SEQ.

RNEXT: Reference sequence name of the primary alignment of the NEXT read in the template. For the last read, the next read is the first read in the template. If @SQ header lines are present, RNEXT (if not ‘’ or ‘=’) must be present in one of the SQ-SN tag. This field is set as ‘’ when the information is unavailable, and set as ‘=’ if RNEXT is identical RNAME. If not ‘=’ and the next read in the template has one primary mapping (see also bit 0x100 in FLAG), this field is identical to RNAME at the primary line of the next read. If RNEXT is ‘*’, no assumptions can be made on PNEXT and bit 0x20.
PNEXT: 1-based Position of the primary alignment of the NEXT read in the template. Set as 0 when the information is unavailable. This field equals POS at the primary line of the next read. If PNEXT is 0, no assumptions can be made on RNEXT and bit 0x20.
TLEN: signed observed Template LENgth. If all segments are mapped to the same reference sequence, the absolute value of TLEN equals the distance between the mapped end of the template and the mapped start of the template, inclusively (i.e., end − start + 1).¹² Note that mapped base is defined to be one that aligns to the reference as described by CIGAR, hence excludes soft-clipped bases. The TLEN field is positive for the leftmost segment of the template, negative for the rightmost, and the sign for any middle segment is undefined. If segments cover the same coordinates then the choice of which is leftmost and rightmost is arbitrary, but the two ends must still have differing signs. It is set
as 0 for a single-segment template or when the information is unavailable (e.g., when the first or last segment of a multi-segment template is unmapped or when the two are mapped to different reference sequences).

The intention of this field is to indicate where the other end of the template has been aligned without needing to read the remainder of the SAM file. Unfortunately there has been no clear consensus on the definitions of the template mapped start and end. Thus the exact definitions are implementationdefined.¹³

Read 1 Read 2
TLEN #1/#2
Unambiguous scenario
Read 1
Read 2
TLEN#2
TLEN#1
Ambiguous scenario

SEQ: segment SEQuence. This field can be a ‘’ when the sequence is not stored. If not a ‘’, the length of the sequence must equal the sum of lengths of M/I/S/=/X operations in CIGAR. An ‘=’ denotes the base is identical to the reference base. No assumptions can be made on the letter cases.
QUAL: ASCII of base QUALity plus 33 (same as the quality string in the Sanger FASTQ format). A
base quality is the phred-scaled base error probability which equals −10 log10 Prfbase is wrongg. This field can be a ‘’ when quality is not stored. If not a ‘’, SEQ must not be a ‘*’ and the length of the quality string ought to equal the length of SEQ.

1.5 The alignment section: optional fields

All optional fields follow the TAG:TYPE:VALUE format where TAG is a two-character string that matches /[A-Za-z][A-Za-z0-9]/. Each TAG can only appear once in one alignment line. A TAG containing lowercase letters are reserved for end users. In an optional field, TYPE is a single case-sensitive letter which defines the format of VALUE:

Type	Regexp matching VALUE	Description
A	[!-~]	Printable character
i	[-+]?[0-9]+	Signed integer¹⁴
f	[-+]?[0-9]*.?[0-9]+([eE][-+]?[0-9]+)?	Single-precision floating number
Z	[ !-~]*	Printable string, including space
H	([0-9A-F][0-9A-F])*	Byte array in the Hex format¹⁵
B	cCsSiIf*	Integer or numeric array

For an integer or numeric array (type ‘B’), the first letter indicates the type of numbers in the following comma separated array. The letter can be one of ‘cCsSiIf’, corresponding to int8 t (signed 8-bit integer), uint8 t (unsigned 8-bit integer), int16 t, uint16 t, int32 t, uint32 t and float, respectively.¹⁶ During import/export, the element type may be changed if the new type is also compatible with the array.

Predefined tags are described in the separate Sequence Alignment/Map Optional Fields Specification.¹⁷ See that document for details of existing standard tag fields and conventions around creating new tags that may be of general interest. Tags starting with ‘X’, ‘Y’ or ‘Z’ and tags containing lowercase letters in either position are reserved for local use and will not be formally defined in any future version of these specifications.

2 Recommended Practice for the SAM Format

This section describes the best practice for representing data in the SAM format. They are not required in general, but may be required by a specific software package for it to function properly.

The header section
1. The @HD line should be present, with either the SO tag or the GO tag (but not both) specified.
2. The @SQ lines should be present if reads have been mapped.
3. When a RG tag appears anywhere in the alignment section, there should be a single corresponding @RG line with matching ID tag in the header.
4. When a PG tag appears anywhere in the alignment section, there should be a single corresponding @PG line with matching ID tag in the header.
Adjacent CIGAR operations should be different.
No alignments should be assigned mapping quality 255.
Unmapped reads
1. For a unmapped paired-end or mate-pair read whose mate is mapped, the unmapped read should have RNAME and POS identical to its mate.
2. If all segments in a template are unmapped, their RNAME should be set as ‘*’ and POS as 0.
3. If POS plus the sum of lengths of M/=/X/D/N operations in CIGAR exceeds the length specified in the LN field of the @SQ header line (if exists) with an SN equal to RNAME, the alignment should be unmapped, unless the reference sequence is circular (see below).
4. Unmapped reads should be stored in the orientation in which they came off the sequencing machine and have their reverse flag bit (0x10) correspondingly unset.
Multiple mapping
1. When one segment is present in multiple lines to represent a multiple mapping of the segment, only one of these records should have the secondary alignment flag bit (0x100) unset. RNEXT and PNEXT point to the primary line of the next read in the template.
2. SEQ and QUAL of secondary alignments should be set to ‘*’ to reduce the file size.
Optional tags:
1. If the template has more than 2 segments, the TC tag should be present.
2. The NM tag should be present.
Circular reference sequences
Mappings that cross the coordinate ‘join’ in circular reference sequences (i.e., those whose @SQ headers specify TP:circular) may be represented as follows:
1. (Preferred) As usual POS should be between 1 and the @SQ header’s LN value, but POS plus the sum of the lengths of M/=/X/D/N CIGAR operations may exceed LN. Coordinates greater than LN are interpreted by subtracting LN so that bases at LN+1; LN+2; LN+3; : : : are considered to be mapped at positions 1; 2; 3; : : :; thus each (1-based) position p is interpreted as ((p − 1) mod LN) + 1.¹⁸
2. Alternatively, such alignments may be split across several records: one record representing the initial portion of the segment ending at LN, one representing the final portion starting from 1, and any other records representing additional portions in between spanning the entire reference sequence. One record (chosen arbitrarily) is considered primary and the remainder have their supplementary flag bit (0x800) set.
Annotation dummy reads: These have SEQ set to *, FLAG bits 0x100 and 0x200 set (secondary and filtered), and a CT tag.
1. If you wish to store free text in a CT tag, use the key value Note (uppercase N) to match GFF3.
2. Multi-segment annotation (e.g., a gene with introns) should be described with multiple lines in SAM (like a multi-segment read). Where there is a clear biological direction (e.g., a gene), the first segment (FLAG bit 0x40) is used for the first section (e.g., the 50 end of the gene). Thus a GenBank entry location like complement(join(85052..85354, 85441..85621, 86097..86284)) would have three lines in SAM with a common QNAME:

FLAG POS CIGAR Optional fields
The 50 fragment 883 (0x373) 86097 188M FI:i:1 TC:i:3
Middle fragment 819 (0x333) 85441 181M FI:i:2 TC:i:3
The 30 fragment 947 (0x3B3) 85052 303M FI:i:3 TC:i:3

If converting GFF3 to SAM, store any key, values from column 9 in the CT tag, except for the unique ID which is used for the QNAME. GFF3 columns 1 (seqid), 4 (start) and 5 (end) are encoded using SAM columns RNAME, POS and CIGAR to hold the length. GFF3 columns 3 (type) and 7 (strand) are stored explicitly in the CT tag. Remaining GFF3 columns 2 (source), 6 (score), and 8 (phase) are stored in the CT tag using key values FSource, FScore and FPhase (uppercase keys are restricted in GFF3, so these names avoid clashes). Split location features are described with multiple lines in GFF3, and similarly become multi-segment dummy reads in SAM, with the RNEXT and PNEXT columns filled in appropriately. In the absence of a convention in SAM/BAM for reads wrapping the origin of a circular genome, any GFF3 feature line wrapping the origin must be split into two segments in SAM.

3 Guide for Describing Assembly Sequences in SAM

3.1 Unpadded versus padded representation

To describe alignments, we can regard the reference sequence with no respect to other alignments against it. Such a reference sequence is called an unpadded reference. A position on an unpadded reference, referred to as an unpadded position, is not affected by any alignments. When we use unpadded references and positions to describe alignments, we say we are using the unpadded representation.

Alternatively, to describe the same alignments, we can modify the reference sequence to contain pads that make room for sequences inserted relative to the reference. A pad is effectively a gap and conventionally represented by an asterisk ‘*’. A reference sequence containing pads is called a padded reference. A position which counts the *’s is referred to as a padded position. A padded reference sequence may be affected by the query alignments and because of gap insertions is typically longer than the unpadded reference. The padded position of one query alignment may be affected by other query alignments.
Unpadded and padded are different representations of the same alignments. They are convertible to each other with no loss of any information.

The unpadded representation is more common due to the convenience of a fixed coordinate system, while the padded representation has the advantage that alignments can be simply described by the start and end coordinates without using complex CIGAR strings. SAM traditionally uses the padded representation for de novo assembly. The ACE assembly format uses the padded representation exclusively.

3.2 Padded SAM

The SAM format is typically used to describe alignments against an unpadded reference sequence, but it is also able to describe alignments against a padded reference. In the latter case, we say we are using a padded SAM. A padded SAM is a valid SAM, but with the difference that the reference and positions in use are padded. There may be more than one way to describe the padded representation. We recommend the following; see also the discussion in Cock et al.¹⁹

In a padded SAM, alignments and coordinates are described with respect to the padded reference sequence. Unlike traditional padded representations like the ACE file format where pads/gaps are recorded in reads using *’s, we do not write *’s in the SEQ field of the SAM format.22 Instead, we describe pads in the query sequences as deletions from the padded reference using the CIGAR ‘D’ operation. In a padded SAM, the insertion and padding CIGAR operations (‘I’ and ‘P’) are not used because the padded reference already
considers all the insertions.

The following shows the padded SAM for the example alignment in Section 1.1. Notably, the length of ref is 47 instead of 45. POS of the last three alignments are all shifted by 2. CIGAR of alignments bridging the 2bp insertion are also changed.

@HD VN:1.6 SO:coordinate
@SQ SN:ref LN:47
ref 516 ref 1 0 14M2D31M * 0 0 AGCATGTTAGATAAGATAGCTGTGCTAGTAGGCAGTCAGCGCCAT *
r001 99 ref 7 30 14M1D3M = 39 41 TTAGATAAAGGATACTG *
* 768 ref 8 30 1M * 0 0 * * CT:Z:.;Warning;Note=Ref wrong?
r002 0 ref 9 30 3S6M1D5M * 0 0 AAAAGATAAGGATA * PT:Z:1;4;+;homopolymer
r003 0 ref 9 30 5H6M * 0 0 AGCTAA * NM:i:1
r004 0 ref 18 30 6M14N5M * 0 0 ATAGCTTCAGC *
r003 2064 ref 31 30 6H5M * 0 0 TAGGC * NM:i:0
r001 147 ref 39 30 9M = 7 -41 CAGCGGCAT * NM:i:1

Here we also exemplify the recommended practice for storing the reference sequence and the reference annotations in SAM when necessary. For a reference sequence in SAM, QNAME should be identical to RNAME, POS set to 1 and FLAG to 516 (filtered and unmapped); for an annotation, FLAG should be set to 768 (filtered and secondary) with no restriction to QNAME. Dummy reads for annotation would typically have a CT tag to hold the annotation information; see the discussion of dummy reads in Section 2. See also the separate Optional Fields Specification for full details of the CT and PT annotation tags.23

4 The BAM Format Specification

4.1 The BGZF compression format

BGZF is block compression implemented on top of the standard gzip file format.24 The goal of BGZF is to provide good compression while allowing efficient random access to the BAM file for indexed queries. The BGZF format is ‘gunzip compatible’, in the sense that a compliant gunzip utility can decompress a BGZF compressed file.25

A BGZF file is a series of concatenated BGZF blocks, each no larger than 64Kb before or after compression. Each BGZF block is itself a spec-compliant gzip archive which contains an \extra field" in the format described in RFC1952. The gzip file format allows the inclusion of application-specific extra fields and these are ignored by compliant decompression implementation. The gzip specification also allows gzip files to be concatenated. The result of decompressing concatenated gzip files is the concatenation of the uncompressed data.

Each BGZF block contains a standard gzip file header with the following standard-compliant extensions:

The F.EXTRA bit in the header is set to indicate that extra fields are present.
The extra field used by BGZF uses the two subfield ID values 66 and 67 (ascii ‘BC’).
The length of the BGZF extra field payload (field LEN in the gzip specification) is 2 (two bytes of payload).
The payload of the BGZF extra field is a 16-bit unsigned integer in little endian format. This integer gives the size of the containing BGZF block minus one.

On disk, a complete BGZF file is a series of blocks as shown in the following table. (All integers are little endian as is required by RFC1952.)

Field	Description	Type	Value
	List of compression blocks (until the end of the file)
ID1	gzip IDentifier1	uint8 t	31
ID2	gzip IDentifier2	uint8 t	139
CM	gzip Compression Method	uint8 t	8
FLG	gzip FLaGs	uint8 t	4
MTIME	gzip Modification TIME	uint32 t
XFL	gzip eXtra FLags	uint8 t
OS	gzip Operating System	uint8 t
XLEN	gzip eXtra LENgth	uint16 t
	Extra subfield(s) (total size=XLEN)
	Additional RFC1952 extra subfields if present
SI1	Subfield Identifier1	uint8 t	66
SI2	Subfield Identifier2	uint8 t	67
SLEN	Subfield LENgth	uint16 t	2
BSIZE	total Block SIZE minus 1	uint16 t
	Additional RFC1952 extra subfields if present
CDATA	Compressed DATA by zlib::deflate()	uint8 t[BSIZE-XLEN-19]
CRC32	CRC-32	uint32 t
ISIZE	Input SIZE (length of uncompressed data)	uint32 t

The random access method to be described next limits the uncompressed contents of each BGZF block
to a maximum of 216 bytes of data. Thus while ISIZE is stored as a uint32 t as per the gzip format, in
BGZF it is limited to the range [0; 65536]. BSIZE can represent BGZF block sizes in the range [1; 65536],
though typically BSIZE will be rather less than ISIZE due to compression.

4.1.1 Random access

BGZF files support random access through the BAM file index. To achieve this, the BAM file index uses virtual file offsets into the BGZF file. Each virtual file offset is an unsigned 64-bit integer, defined as: coffset<<16|uoffset, where coffset is an unsigned byte offset into the BGZF file to the beginning of a BGZF block, and uoffset is an unsigned byte offset into the uncompressed data stream represented by that BGZF block. Virtual file offsets can be compared, but subtraction between virtual file offsets and addition between a virtual offset and an integer are both disallowed.

4.1.2 End-of-file marker

An end-of-file (EOF) trailer or marker block should be written at the end of BGZF files, so that unintended file truncation can be easily detected. The EOF marker block is a particular empty26 BGZF block encoded with the default zlib compression level settings, and consists of the following 28 hexadecimal bytes:

1f 8b 08 04 00 00 00 00 00 ff 06 00 42 43 02 00 1b 00 03 00 00 00 00 00 00 00 00 00

The presence of this EOF marker at the end of a BGZF file indicates that the immediately following physical EOF is the end of the file as intended by the program that wrote it. Empty BGZF blocks are not otherwise special; in particular, the presence of an EOF marker block does not by itself signal end of file.27

The absence of this final EOF marker should trigger a warning or error soon after opening a BGZF file where random access is available.28 When reading a BGZF file in sequential streaming fashion, ideally this EOF check should be performed when the end of the stream is reached. Checking that the final BGZF block in the file decompresses to empty or checking that the last 28 bytes of the file are exactly the bytes above are both sufficient tests; each is likely more convenient in different circumstances.

4.2 The BAM format

BAM is compressed in the BGZF format. All multi-byte numbers in BAM are little-endian, regardless of the machine endianness. The format is formally described in the following table where values in brackets are the default when the corresponding information is not available; an underlined word in uppercase denotes a field in the SAM format.

|Field  | Description                                              | Type     | Value    |
|-------|----------------------------------------------------------|----------|----------|
|magic  | BAM magic string                                         | char[4]  | BAM\1    |
|l text | Length of the header text, including any NUL padding     | uint32 t | < 231    |
|text   | Plain header text in SAM; not necessarily NUL-terminated | char[l text] |      |
|n ref  | # reference sequences                                    | uint32 t | < 231    |
|       | List of reference information (n=n ref )                 |          |          |
|l name | Length of the reference name plus 1 (including NUL)      | uint32 t | limited  |
|name   | Reference sequence name; NUL-terminated                  | char[l name] |      |
|l ref  | Length of the reference sequence                         | uint32 t | < 231    |
|       | List of alignments (until the end of the file)           |          |          |
|       |block size Total length of the alignment record, excluding this field | uint32 t | limited |
| refID | Reference sequence ID, −1 ≤ refID < n ref; -1 for a read without a mapping position | int32 t | [-1]|
pos 0-based leftmost coordinate (= POS − 1) int32 t [-1]
l read name Length of read name below (= length(QNAME) + 1) uint8 t
mapq Mapping quality (=MAPQ) uint8 t
bin BAI index bin, see Section 4.2.1 uint16 t
n cigar op Number of operations in CIGAR, see Section 4.2.2 uint16 t
flag Bitwise flags (= FLAG)29 uint16 t
l seq Length of SEQ uint32 t limited
next refID Ref-ID of the next segment (−1 ≤ next refID < n ref) int32 t [-1]
next pos 0-based leftmost pos of the next segment (= PNEXT − 1) int32 t [-1]
tlen Template length (= TLEN) int32 t [0]
read name Read name, NUL-terminated (QNAME with trailing ‘\0’)30 char[l read name]
cigar CIGAR: op len<<4|op. ‘MIDNSHP=X’!‘012345678’ uint32 t[n cigar op]
seq 4-bit encoded read: ‘=ACMGRSVTWYHKDBN’! [0; 15]. See
Section 4.2.3
uint8 t[(l seq+1)/2]
qual Phred-scaled base qualities. See Section 4.2.3 char[l seq]
List of auxiliary data (until the end of the alignment block)
tag Two-character tag char[2]
val type Value type: AcCsSiIfZHB, see Section 4.2.4 char
value Tag value (by val type)

Most length and count fields described as uint32 t have additional constraints on their range: l text < 231 due to implementation limits; n ref < 231 because refID and next refID are signed; l ref < 231 because tlen is signed; those marked \limited" are limited by available memory and the practical size of the data represented well before they are limited by, e.g., Java’s signed 32-bit integer maximum array size.

4.2.1 BIN field calculation
BIN is calculated using the reg2bin() function in Section 5.3. For mapped reads this uses POS-1 (i.e., 0-based left position) and the alignment end point using the alignment length from the CIGAR string. For unmapped reads (e.g., paired end reads where only one part is mapped, see Section 2) the alignment is treated as being ength one. Note unmapped reads with POS 0 (which becomes −1 in BAM) therefore use reg2bin(-1, 0) which is 4680.

4.2.2 N CIGAR OP field

With 16 bits, n cigar op can keep at most 65535 CIGAR operations in BAM files. For an alignment with more CIGAR operations, BAM stores the real CIGAR, encoded the same way as the cigar field in BAM, in the CG optional tag of type ‘B,I’, and sets CIGAR to ‘kSmN’ as a placeholder, where ‘k’ equals l seq, ‘m’ is the reference sequence length in the alignment, and ‘S’ and ‘N’ are the soft-clipping and reference-clip CIGAR operators, respectively|i.e., in the binary form, n cigar op=2 and cigar=[k <<4|4,m <<4|3]. If tag CG is present and the first CIGAR operation clips the entire read, a BAM parsing library is expected to update n cigar op and cigar with the real CIGAR stored in the CG tag and remove the now-redundant CG tag.

4.2.3 SEQ and QUAL encoding

Sequence is encoded in 4-bit values, with adjacent bases packed into the same byte starting with the highest 4 bits first. When l seq is odd the bottom 4 bits of the last byte are undefined, but we recommend writing these as zero. The case-insensitive base codes ‘=ACMGRSVTWYHKDBN’ are mapped to [0; 15] respectively with all other characters mapping to ‘N’ (value 15).

Omitted sequence, represented in SAM as ‘*’, is represented by l seq being 0 and seq and qual zero-length.

Base qualities are stored as bytes in the range [0; 93], without any +33 conversion to printable ASCII. When base qualities are omitted but the sequence is not, qual is filled with 0xFF bytes (to length l seq).

4.2.4 Auxiliary data encoding

Optional alignment fields are stored immediately after each other immediately following the qual field, and are included in block size. Each field is represented as a two-character tag followed by a single type character and then its value, whose length is determined by the field’s type.

Single character ‘A’ fields have a total length of 4 bytes, with the value represented as a single byte:

tag A char

While all single (i.e., non-array) integer types are stored in SAM as ‘i’, in BAM any of ‘cCsSiI’ may be used together with the correspondingly-sized binary integer value, chosen according to the field value’s magnitude.31 Similarly floating point ‘f’ fields are represented as IEEE 754-2008 binary32 values. Thus BAM numeric fields have a total length of 4, 5, or 7 bytes:

tag c i8 (i.e., int8 t) tag i int32 t
tag C u8 (i.e., uint8 t) tag I uint32 t
tag s int16 t tag f float
tag S uint16 t

String fields and hex-formatted byte arrays are represented as NUL-terminated text strings:32

tag Z char char · · · char NUL
tag H hex hex hex hex · · · hex hex NUL

The representation of a ‘B’ array field starts with a sub-type character similar to the numeric field types above and a count (uint32 t, but limited by memory and block size) giving the number of elements in the array. The array elements follow, encoded as binary integers or IEEE floats sized according to the sub-type:

tag B c count i8 i8 · · · i8 (i.e., int8 t elements)
tag B C count u8 u8 · · · u8 (i.e., uint8 t elements)
tag B s count int16 t int16 t · · · int16 t
tag B S count uint16 t uint16 t · · · uint16 t
tag B i count int32 t int32 t · · · int32 t
tag B I count uint32 t uint32 t · · · uint32 t
tag B f count float float · · · float

5 Indexing BAM

Indexing aims to achieve fast retrieval of alignments overlapping a specified region without going through the whole alignments. BAM must be sorted by the reference ID and then the leftmost coordinate before indexing.

This section describes the binning scheme underlying coordinate-sorted BAM indices and its implementation in the long-established BAI format. The CSI format documented elsewhere uses a similar binning scheme and can also be used to index BAM.33

5.1 Algorithm

5.1.1 Basic binning index

The UCSC binning scheme was suggested by Richard Durbin and Lincoln Stein and is explained in Kent et al.34 In this scheme, each bin represents a contiguous genomic region which is either fully contained in or non-overlapping with another bin; each alignment is associated with a bin which represents the smallest region containing the entire alignment. The binning scheme is essentially a representation of R-tree. A distinct bin uniquely corresponds to a distinct internal node in a R-tree. Bin A is a child of Bin B if the region represented by A is contained in B.

To find the alignments that overlap a specified region, we need to get the bins that overlap the region, and then test each alignment in the bins to check overlap. To quickly find alignments associated with a specified bin, we can keep in the index the start file offsets of chunks of alignments which all have the bin. As alignments are sorted by the leftmost coordinates, alignments having the same bin tend to be clustered together on the disk and therefore usually a bin is only associated with a few chunks. Traversing all the alignments having the same bin usually needs a few seek calls. Given the set of bins that overlap the specified region, we can visit alignments in the order of their leftmost coordinates and stop seeking the rest when an alignment falls outside the required region. This strategy saves half of the seek calls in average.

In the BAI format, each bin may span 229, 226, 223, 220, 217 or 214 bp. Bin 0 spans a 512Mbp region, bins 1{8 span 64Mbp, 9{72 8Mbp, 73{584 1Mbp, 585{4680 128Kbp, and bins 4681{37448 span 16Kbp regions. This implies that this index format does not support reference chromosome sequences longer than 229 − 1.

The CSI format generalises the sizes of the bins, and supports reference sequences of the same length as are supported by SAM and BAM.

5.1.2 Reducing small chunks

Around the boundary of two adjacent bins, we may see many small chunks with some having a shorter bin while the rest having a larger bin. To reduce the number of seek calls, we may join two chunks having the same bin if they are close to each other. After this process, a joined chunk will contain alignments with different bins. We need to keep in the index the file offset of the end of each chunk to identify its boundaries.

5.1.3 Combining with linear index

For an alignment starting beyond 64Mbp, we always need to seek to some chunks in bin 0, which can be avoided by using a linear index. In the linear index, for each tiling 16384bp window on the reference, we record the smallest file offset of the alignments that overlap with the window. Given a region [rbeg, rend), we only need to visit a chunk whose end file offset is larger than the file offset of the 16kbp window containing rbeg.

With both binning and linear indices, we can retrieve alignments in most of regions with just one seek call.

5.1.4 A conceptual example

Suppose we have a genome shorter than 144kbp. We can design a binning scheme which consists of three types of bins: bin 0 spans 0-144kbp, bin 1, 2 and 3 span 48kbp and bins from 4 to 12 span 16kbp each:

0 (0{144kbp)
1 (0{48kbp) 2 (48{96kbp) 3 (96{144kbp)
4 (0{16k) 5 (16{32k) 6 (32{48k) 7 (48{64k) 8 (64{80k) 9 (80{96k) 10 11 12

An alignment starting at 65kbp and ending at 67kbp would have a bin number 8, which is the smallest bin containing the alignment. Similarly, an alignment starting at 51kbp and ending at 70kbp would go to bin 2, while an alignment between [40k, 49k] to bin 0. Suppose we want to find all the alignments overlapping region [65k, 71k). We first calculate that bin 0, 2 and 8 overlap with this region and then traverse the alignments in these bins to find the required alignments. With a binning index alone, we need to visit the alignment at [40k, 49k] as it belongs to bin 0. But with a linear index, we know that such an alignment stops before 64kbp and cannot overlap the specified region. A seek call can thus be saved.

5.2 The BAI index format for BAM files

Field Description Type Value
magic Magic string char[4] BAI\1
n ref # reference sequences uint32 t < 231
List of indices (n=n ref )
n bin # distinct bins (for the binning index) uint32 t ≤ 37451
List of distinct bins (n=n bin)
bin Distinct bin uint32 t ≤ 37450
n chunk # chunks uint32 t limited35
List of chunks (n=n chunk)
chunk beg (Virtual) file offset of the start of the chunk uint64 t
chunk end (Virtual) file offset of the end of the chunk uint64 t
n intv # 16kbp intervals (for the linear index) uint32 t ≤ 217
List of intervals (n=n intv)
ioffset (Virtual) file offset of the first alignment in the interval uint64 t
n no coor (optional) Number of unplaced unmapped reads (RNAME *) uint64 t

The index file may optionally contain additional metadata providing a summary of the number of mapped and placed unmapped read-segments per reference sequence, and of any unplaced unmapped read-segments.36 This is stored in an optional extra metadata pseudo-bin for each reference sequence, and in the optional trailing n no coor field at the end of the file. The pseudo-bins appear in the references’ lists of distinct bins as bin number 37450 (which is beyond the normal range) and are laid out so as to be compatible with real bins and their chunks:

bin Magic bin number uint32 t 37450
n chunk # chunks uint32 t 2
ref beg (Virtual) file offset of the start of reads placed on this reference uint64 t
ref end (Virtual) file offset of the end of reads placed on this reference uint64 t
n mapped Number of mapped read-segments for this reference uint64 t
n unmapped Number of unmapped read-segments for this reference uint64 t

The ref beg/ref end fields locate the first and last reads on this reference sequence, whether they are mapped or placed unmapped. Thus they are equal to the minimum chunk beg and maximum chunk end respectively.

5.3 C source code for computing bin number and overlapping bins

The following functions compute bin numbers and overlaps for a BAI-style binning scheme with 6 levels and a minimum bin size of 214 bp. See the CSI specification for generalisations of these functions designed for binning schemes with arbitrary depth and sizes.

/* calculate bin given an alignment covering [beg,end) (zero-based, half-closed-half-open) */
int reg2bin(int beg, int end)
{
--end;
if (beg>>14 == end>>14) return ((1<<15)-1)/7 + (beg>>14);
if (beg>>17 == end>>17) return ((1<<12)-1)/7 + (beg>>17);
if (beg>>20 == end>>20) return ((1<<9)-1)/7 + (beg>>20);
if (beg>>23 == end>>23) return ((1<<6)-1)/7 + (beg>>23);
if (beg>>26 == end>>26) return ((1<<3)-1)/7 + (beg>>26);
return 0;
}
/* calculate the list of bins that may overlap with region [beg,end) (zero-based) */
#define MAX_BIN (((1<<18)-1)/7)
int reg2bins(int beg, int end, uint16_t list[MAX_BIN])
{
int i = 0, k;
--end;
list[i++] = 0;
for (k = 1 + (beg>>26); k <= 1 + (end>>26); ++k) list[i++] = k;
for (k = 9 + (beg>>23); k <= 9 + (end>>23); ++k) list[i++] = k;
for (k = 73 + (beg>>20); k <= 73 + (end>>20); ++k) list[i++] = k;
for (k = 585 + (beg>>17); k <= 585 + (end>>17); ++k) list[i++] = k;
for (k = 4681 + (beg>>14); k <= 4681 + (end>>14); ++k) list[i++] = k;
return i;
}

Appendix A Parsing region notation

Parsing region notation such as name:begin[-end] would be simple if name could not itself contain ‘:’ characters, but this is not the case. (No such notation containing an optional ‘:’ appears in the SAM format itself, but various tools use this notation as a convenient way for their users to specify regions of interest.)

The set of valid reference sequence names is usually already known when parsing this notation-for example, because the associated @SQ headers have already been encountered. Tools can use this set to determine unambiguously which colons could delimit a known-valid reference sequence name.

In pseudocode form, a string str can be parsed as follows:

consider the rightmost ‘:’ character, if any, of str
if str is of the form ‘prefix:NUM’ or ‘prefix:NUM-NUM’
or generally ‘prefix:suffix’ for some plausible interval suffix
then
if both prefix and str are in the known set then . . . error: ambiguous representation
else if prefix is in the known set then return (prefix, NUM. . . NUM)
else if str is in the known set then return (str, entire sequence)
else . . . error: unknown reference sequence name
else . . . either str does not contain a colon or the suffix is not plausibly numeric
if str is in the known set then return (str, entire sequence)
else . . . error: unknown reference sequence name or invalid interval syntax

The check leading to \error: ambiguous representation" is important as it prevents confusing interpretations of actually ambiguous input. Typically the set of valid reference sequence names will not contain names that are prefixes of other names in the set, so in practice this error will not usually be encountered in non-malicious data.

Either in addition to this algorithm or as an alternative to it, tools can use additional delimiter characters to make an unambiguously parsable notation. We recommend a convention using curly brackets around the reference sequence name| {name}[:begin[-end]] |as being memorable, easily typed, unambiguous, and not expanded by most shells.

Appendix B SAM Version History

This lists the date of each tagged SAM version along with changes that have been made while that version was current. The key changes that caused the version number to change are shown in bold.

Additions and changes to the standard predefined tags are listed in the separate Sequence Alignment/Map Optional Fields Specification.37

1.6: 28 November 2017 to current

Correct the description of index pseudo-bins, which previously stated that ref beg/ref end, then named unmapped beg/unmapped end, include only placed unmapped reads. (Jul 2020)
Add DNBSEQ to the list of @RG PL header tag values. (Apr 2020)
Add @SQ TP circular/linear topology header tag. (May 2019)
Restricted the allowable punctuation characters in reference sequence names (in @SQ SN, RNAME, etc). The sets of characters allowed in @SQ SN and @SQ AN are now identical, which enlarges the previous AN set. (Jan 2019) We recommend that implementations validating reference sequence names do so using the rules in Section 1.2.1; are more lenient for files declaring @HD VN ≤ 1:5; and validate AN only against these rules, not the previous more restrictive AN rules.

37See Appendix A of SAMtags.pdf at https://github.com/samtools/hts-specs.

Add @HD SS sorting details header tag. (Oct 2018)
B array optional fields may have no entries|this was already representable in BAM, clarified that empty arrays are permitted in SAM too. (Jul 2018)
Add @SQ DS header tag. (Jul 2018)
Add @RG BC header tag. (Apr 2018)
Permit UTF-8 in a few header tags. (Mar 2018)
Add support for CIGAR strings with more than 65,535 operations. (Nov 2017) 1.5: 23 May 2013 to November 2017
Add @SQ AN header tag, allowing only alphanumeric and ‘*+.@_|-’ characters in its names. (Jul 2017)
Add @SQ AH header tag. (Mar 2017)
Auxiliary tags migrated to SAMtags document. (Sep 2016)
Z and H auxiliary tags are permitted to be zero length. (Jun 2016)
QNAME limited to 254 bytes (was 255). (Aug 2015)
Generalise 0x200 flag bit as filtered-out bit. (Aug 2015)
Add @HD GO for group order. (Mar 2015)
Add ONT to the @RG PL and @RG PM header tags. (Mar 2015)
Add meaning to reverse FLAG on unmapped reads. (Mar 2015)
Document the idxstats .bai elements. (Nov 2014)
Addition of CSI index. (Sep 2014)
Add @PG DS header field. (Dec 2013)
Document the BAM EOF byte values. (Dec 2013)
Glossary of alignment types. (May 2013)
Note that PNEXT/RNEXT points to next read, not segment. (May 2013)
Add SUPPLEMENTARY flag bit. (May 2013)

1.4: 21 April 2011 to May 2013

Add guide to using sequence annotations (CT/PT tags). (Mar 2012)
Increase max reference length from 229 to 231. (Sep 2011)
Clarify @SQ M5 header tag generation. (Sep 2011)
Describe padded alignments. (Sep 2011)
Add @RG FO, KS header fields. (Apr 2011)
Clarify chaining of PG records. (Apr 2011)
Add B array auxiliary tag type. (Apr 2011)
Permit IUPAC in SEQ and MD auxiliary tag. (Apr 2011)
Permit QNAME *". (Apr 2011)

1.3: July 2010 to April 2011

Add RG PG header field. (Nov 2010)
Add BAM description and index sections. (Nov 2010)
Removal of FLAG letters. (July 2010)
The SM header field, previously mandatory for @RG, is now optional. (July 2010)

1.0: 2009 to July 2010

Initial edition.

Charset ANSI X3.4-1968 as defined in RFC1345. ↩
The values in the FLAG column correspond to bitwise flags as follows: 99 = 0x63: first/next is reverse-complemented/properly aligned/multiple segments; 0: no flags set, thus a mapped single segment; 2064 = 0x810: supplementary/reversecomplemented; 147 = 0x93: last (second of a pair)/reverse-complemented/properly aligned/multiple segments. ↩
Chimeric alignments are primarily caused by structural variations, gene fusions, misassemblies, RNA-seq or experimental protocols. They are more frequent given longer reads. For a chimeric alignment, the linear alignments constituting the alignment are largely non-overlapping; each linear alignment may have high mapping quality and is informative in SNP/INDEL calling. In contrast, multiple mappings are caused primarily by repeats. They are less frequent given longer reads. If a read has multiple mappings, all these mappings are almost entirely overlapping with each other; except the single-best optimal mapping, all the other mappings get mapping quality <Q3 and are ignored by most SNP/INDEL callers. ↩
Characters that are not disallowed include ‘|’, which historically appeared in reference names derived from NCBI FASTA files, and ‘:’, which appears in HLA allele names. Appendix A describes approaches for parsing name[:begin-end] region notation unambiguously even though name may itself contain colons. ↩
Best practice is to use lowercase tags while designing and experimenting with new data field tags or for fields of local interest only. For new tags that are of general interest, raise an hts-specs issue or email samtools-devel@lists.sourceforge.net to have an uppercase equivalent added to the specification. This way collisions of the same uppercase tag being used with different meanings can be avoided. ↩
It is known that widely used software libraries have differing definitions of the queryname sort order, meaning care should be taken when operating on multiple files of varying provenance. Tools may wish to use the sub-sort field to explicitly distinguish　between natural and lexicographical ordering. See Section 1.3.1. ↩
The repetition of sort-order enables a limited form of validation. For example, @HD SO:queryname SS:coordinate:TLEN would indicate that the data has been re-sorted (by query name) by a non-SS-aware tool and the SS field should be ignored. ↩
See https://www.ncbi.nlm.nih.gov/grc/help/definitions for descriptions of alternate locus and primary assembly. ↩
For example, given ‘@SQ SN:MT AN:chrMT,M,chrM LN:16569 TP:circular’, tools can ensure that a user’s request for any of ‘MT’, ‘chrMT’, ‘M’, or ‘chrM’ succeeds and refers to the same sequence. ↩
The previous footnote’s example identifies MT as a circular chromosome. The TP field is often omitted, which implies linear. ↩
The manipulation of bitwise flags is described at Wikipedia (see \Flag field") and elsewhere. ↩
Thus a segment aligning in the forward direction at base 100 for length 50 and a segment aligning in the reverse direction at base 200 for length 50 indicate the template covers bases 100 to 249 and has length 150. ↩
The earliest versions of this specification used 50 to 50 (in original orientation, TLEN#1; dashed parts of the reads indicate soft-clipped bases) while later ones used leftmost to rightmost mapped base (TLEN#2). Note: these two definitions agree in most alignments, but differ in the case of overlaps where the first segment aligns beyond the start of the last segment. ↩
The number of digits in an integer optional field is not explicitly limited in SAM. However, BAM can represent values in the range [−231; 232), so in practice this is the realistic range of values for SAM’s ‘i’ as well. ↩
For example, the six-character Hex string ‘1AE301’ represents the byte array [0x1a; 0xe3; 0x1]. ↩
Explicit typing eases format parsing and helps to reduce the file size when SAM is converted to BAM. ↩
See SAMtags.pdf at https://github.com/samtools/hts-specs. ↩
The impact of this representation on indexing and random access is yet to be explored by implementations. ↩
Peter J. A. Cock, James K. Bonfield, Bastien Chevreux, and Heng Li, SAM/BAM format v1.5 extensions for de novo assemblies, bioRxiv 020024; doi:10.1101/020024. ↩

【機械翻訳用】Sequence Alignment/Map Format Specification